alpha7nACHR_Nacho_mCherry
(Plasmid
#182939)
-
Purposealpha7 nACHR expression in mammalian cell lines
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182939 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonesynthesized
-
Vector typeMammalian Expression ; Synthesized
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNACH7
-
Alt namealpha7 nicotinic acetylcholine receptor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1508
-
GenBank IDU40583.2
-
Entrez GeneCHRNA7 (a.k.a. CHRNA7-2, NACHRA7)
- Promoter EF1alpha
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CCTCACATTGCCAAAAGACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthesized based on Genbank sequence
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
alpha7 nicotinic acetylcholine receptor cloned upstream of IRES-Nacho sequence to allow alpha7 expression in mammalian cells with chaperone protein NACHO (TMEM35a). The plasmid contains CMV-mCherry to report transfected cells.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
alpha7nACHR_Nacho_mCherry was a gift from Robert Brenner (Addgene plasmid # 182939 ; http://n2t.net/addgene:182939 ; RRID:Addgene_182939) -
For your References section:
Dequalinium chloride is an antagonists of alpha7 nicotinic acetylcholine receptors. Belanger-Coast MG, Zhang M, Bugay V, Gutierrez RA, Gregory SR, Yu W, Brenner R. Eur J Pharmacol. 2022 Jun 15;925:175000. doi: 10.1016/j.ejphar.2022.175000. Epub 2022 May 4. 10.1016/j.ejphar.2022.175000 PubMed 35525312