pJEC637
(Plasmid
#182956)
-
PurposeAD-SYNZIP: αNTD (P. aeruginosa) – SYNZIP17
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCloDF13
- Backbone size w/o insert (bp) 2400
- Total vector size (bp) 3208
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAlphaNTD( P. aeruginosa) - SynZip17
-
SpeciesP. aeruginosa
-
Insert Size (bp)861
- Promoter J23106
-
Tag
/ Fusion Protein
- SynZip17 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctcttcaaatgtagcacctg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEC637 was a gift from James Chappell (Addgene plasmid # 182956 ; http://n2t.net/addgene:182956 ; RRID:Addgene_182956) -
For your References section:
Uncovering the Distinct Properties of a Bacterial Type I-E CRISPR Activation System. Villegas Kcam MC, Tsong AJ, Chappell J. ACS Synth Biol. 2022 Jan 25. doi: 10.1021/acssynbio.1c00496. 10.1021/acssynbio.1c00496 PubMed 35077145