pDY380
(Plasmid
#182962)
-
PurposeAmp-resistant, low copy (p15A ori), E. coli 5'ptsI transcriptionally fused with GFP.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC177
- Total vector size (bp) 3941
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionssee publication
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameptsI
-
Alt nameEnzyme I; Enzyme Isugar; EIsugar; phosphoenolpyruvate-protein phosphotransferase PtsI
-
SpeciesE. coli
-
Insert Size (bp)800
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAGCGAGTCAGTGAGCGAGGAA
- 3′ sequencing primer CGGATACATATTTGAATGTATTTAGAAA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDY380 was a gift from Shelley Copley (Addgene plasmid # 182962 ; http://n2t.net/addgene:182962 ; RRID:Addgene_182962) -
For your References section:
Synonymous edits in the Escherichia coli genome have substantial and condition-dependent effects on fitness. Yang DD, Rusch LM, Widney KA, Morgenthaler AB, Copley SD. Proc Natl Acad Sci U S A. 2024 Jan 30;121(5):e2316834121. doi: 10.1073/pnas.2316834121. Epub 2024 Jan 22. 10.1073/pnas.2316834121 PubMed 38252823