Skip to main content

1161F
(Plasmid #183138)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183138 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBac
  • Total vector size (bp) 11693
  • Vector type
    Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U6.3-gRNAs[sxl, bTub]
  • gRNA/shRNA sequence
    ccgatctggttaccgcattg ttccggagccggtaccgcca acatctttagaccccgaggc ggcggcagcggcgggaatgg gattgtcaactacttgcccc
  • Species
    D. melanogaster (fly); D.suzukii

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1161F was a gift from Omar Akbari (Addgene plasmid # 183138 ; http://n2t.net/addgene:183138 ; RRID:Addgene_183138)
  • For your References section:

    Precision Guided Sterile Males Suppress Populations of an Invasive Crop Pest. Kandul NP, Liu J, Buchman A, Shriner IC, Corder RM, Warsinger-Pepe N, Yang T, Yadav AK, Scott MJ, Marshall JM, Akbari OS. GEN Biotechnology (2022) 1:4, 372-385 10.1089/genbio.2022.0019