promoter-less mRFP1_Violet
(Plasmid
#183139)
-
PurposeBioBrick pSB1C3 plasmid encoding a promoter-less version of mRFP1_Violet
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneBioBrick pSB1C3 vector
-
Backbone manufactureriGEM Registry
-
Modifications to backboneBioBrick sites removed
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRBS, mRFP1E_Violet
-
SpeciesSynthetic
-
Insert Size (bp)767
-
MutationBioBrick sites removed
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BioBrick prefix (unknown if destroyed)
- 3′ cloning site BioBrick suffix (unknown if destroyed)
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
promoter-less mRFP1_Violet was a gift from Anthony Forster (Addgene plasmid # 183139 ; http://n2t.net/addgene:183139 ; RRID:Addgene_183139) -
For your References section:
Overcoming chromoprotein limitations by engineering a red fluorescent protein. Bao L, Menon PNK, Liljeruhm J, Forster AC. Anal Biochem. 2020 Sep 3:113936. doi: 10.1016/j.ab.2020.113936. 10.1016/j.ab.2020.113936 PubMed 32891596