pLV-hIP-dCas9-BSD
(Plasmid
#183231)
-
Purpose(Empty Backbone) Lentiviral vectors with the human insulin promoter driving expression of dCas9, in addition to a U6-driven sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183231 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCRISPRv2
-
Backbone manufacturerFeng Zhang
-
Modifications to backboneCas9-puro replaced by dCas9-BSD. EF1a promoter replaced by the human insulin promoter.
-
Vector typeLentiviral, CRISPR
- Promoter Human insulin promoter
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-hIP-dCas9-BSD was a gift from Jorge Ferrer (Addgene plasmid # 183231 ; http://n2t.net/addgene:183231 ; RRID:Addgene_183231) -
For your References section:
The HASTER lncRNA promoter is a cis-acting transcriptional stabilizer of HNF1A. Beucher A, Miguel-Escalada I, Balboa D, De Vas MG, Maestro MA, Garcia-Hurtado J, Bernal A, Gonzalez-Franco R, Vargiu P, Heyn H, Ravassard P, Ortega S, Ferrer J. Nat Cell Biol. 2022 Oct 6. pii: 10.1038/s41556-022-00996-8. doi: 10.1038/s41556-022-00996-8. 10.1038/s41556-022-00996-8 PubMed 36202974