pFUGW-scrambled
(Plasmid
#183455)
-
PurposeThis control vector contains a scrambled version of the targeting sequence used in the pFUGW-shRIIα construct
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183455 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUGW-H1 empty vector
-
Backbone manufacturerpFUGW-H1 empty vector was a gift from Sally Temple (Addgene plasmid # 25870 ; http://n2t.net/addgene:25870 ; RRID:Addgene_25870)
- Backbone size w/o insert (bp) 10130
-
Vector typeLentiviral
-
Selectable markersZeocin ; GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namescrambled sgRNA
-
gRNA/shRNA sequenceGCCACGTCATAGAGACACTGT
-
SpeciesR. norvegicus (rat)
- Promoter shRNA: H1 / gene: ubiquitin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer shRNA (H1) - 5'tcgctatgtgttctgggaaa; Prkar2a_bp500_F - 5'GAGATGATGGAGACAACTTTTATGTC; Prkar2a_bp1000_F - 5'GGAGAACTTGCCCTGGTGACCA
- 3′ sequencing primer 5'GTTCAGGGGGAGGTGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUGW-scrambled was a gift from Matthew Gold (Addgene plasmid # 183455 ; http://n2t.net/addgene:183455 ; RRID:Addgene_183455) -
For your References section:
AKAP79 enables calcineurin to directly suppress protein kinase A activity. Church TW, Tewatia P, Hannan S, Antunes J, Eriksson O, Smart TG, Hellgren Kotaleski J, Gold MG. Elife. 2021 Oct 6;10. pii: 68164. doi: 10.7554/eLife.68164. 10.7554/eLife.68164 PubMed 34612814