Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFUGW-scrambled
(Plasmid #183455)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 183455 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFUGW-H1 empty vector
  • Backbone manufacturer
    pFUGW-H1 empty vector was a gift from Sally Temple (Addgene plasmid # 25870 ; http://n2t.net/addgene:25870 ; RRID:Addgene_25870)
  • Backbone size w/o insert (bp) 10130
  • Vector type
    Lentiviral
  • Selectable markers
    Zeocin ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    scrambled sgRNA
  • gRNA/shRNA sequence
    GCCACGTCATAGAGACACTGT
  • Species
    R. norvegicus (rat)
  • Promoter shRNA: H1 / gene: ubiquitin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer shRNA (H1) - 5'tcgctatgtgttctgggaaa; Prkar2a_bp500_F - 5'GAGATGATGGAGACAACTTTTATGTC; Prkar2a_bp1000_F - 5'GGAGAACTTGCCCTGGTGACCA
  • 3′ sequencing primer 5'GTTCAGGGGGAGGTGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUGW-scrambled was a gift from Matthew Gold (Addgene plasmid # 183455 ; http://n2t.net/addgene:183455 ; RRID:Addgene_183455)
  • For your References section:

    AKAP79 enables calcineurin to directly suppress protein kinase A activity. Church TW, Tewatia P, Hannan S, Antunes J, Eriksson O, Smart TG, Hellgren Kotaleski J, Gold MG. Elife. 2021 Oct 6;10. pii: 68164. doi: 10.7554/eLife.68164. 10.7554/eLife.68164 PubMed 34612814