Skip to main content

pFUGW-shRIIα-RIIαS97A-IRES-EGFP
(Plasmid #183457)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183457 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFUGW-H1 empty vector
  • Backbone manufacturer
    pFUGW-H1 empty vector was a gift from Sally Temple (Addgene plasmid # 25870 ; http://n2t.net/addgene:25870 ; RRID:Addgene_25870)
  • Backbone size w/o insert (bp) 10130
  • Vector type
    Lentiviral
  • Selectable markers
    Zeocin ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA and Prkar2a
  • Alt name
    cAMP-dependent protein kinase type II-alpha regulatory subunit
  • gRNA/shRNA sequence
    GCCAGGAATCAGACTCGTTCA
  • Species
    R. norvegicus (rat)
  • Mutation
    shRNA-resistant mutations: C135>G, G138>A, A141>G. Phosphodeficient: S97A
  • Entrez Gene
    Prkar2a
  • Promoter shRNA: H1 / gene: ubiquitin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site GOI: AgeI (not destroyed)
  • 3′ cloning site GOI: NheI (not destroyed)
  • 5′ sequencing primer shRNA (H1) - 5'tcgctatgtgttctgggaaa; Prkar2a_bp500_F - 5'GAGATGATGGAGACAACTTTTATGTC; Prkar2a_bp1000_F - 5'GGAGAACTTGCCCTGGTGACCA
  • 3′ sequencing primer 5'GTTCAGGGGGAGGTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We amplified the RIIα coding sequence from a rat hippocampal cDNA library.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Zeo marker is outside the LTRs and will not be packaged into virus.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUGW-shRIIα-RIIαS97A-IRES-EGFP was a gift from Matthew Gold (Addgene plasmid # 183457 ; http://n2t.net/addgene:183457 ; RRID:Addgene_183457)
  • For your References section:

    AKAP79 enables calcineurin to directly suppress protein kinase A activity. Church TW, Tewatia P, Hannan S, Antunes J, Eriksson O, Smart TG, Hellgren Kotaleski J, Gold MG. Elife. 2021 Oct 6;10. pii: 68164. doi: 10.7554/eLife.68164. 10.7554/eLife.68164 PubMed 34612814