pFUGW-shRIIα-RIIαS97A-IRES-EGFP
(Plasmid
#183457)
-
PurposeReplacement of endogenous rat PKA-RIIα subunits with the RIIα S97A variant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFUGW-H1 empty vector
-
Backbone manufacturerpFUGW-H1 empty vector was a gift from Sally Temple (Addgene plasmid # 25870 ; http://n2t.net/addgene:25870 ; RRID:Addgene_25870)
- Backbone size w/o insert (bp) 10130
-
Vector typeLentiviral
-
Selectable markersZeocin ; GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA and Prkar2a
-
Alt namecAMP-dependent protein kinase type II-alpha regulatory subunit
-
gRNA/shRNA sequenceGCCAGGAATCAGACTCGTTCA
-
SpeciesR. norvegicus (rat)
-
MutationshRNA-resistant mutations: C135>G, G138>A, A141>G. Phosphodeficient: S97A
-
Entrez GenePrkar2a
- Promoter shRNA: H1 / gene: ubiquitin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site GOI: AgeI (not destroyed)
- 3′ cloning site GOI: NheI (not destroyed)
- 5′ sequencing primer shRNA (H1) - 5'tcgctatgtgttctgggaaa; Prkar2a_bp500_F - 5'GAGATGATGGAGACAACTTTTATGTC; Prkar2a_bp1000_F - 5'GGAGAACTTGCCCTGGTGACCA
- 3′ sequencing primer 5'GTTCAGGGGGAGGTGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe amplified the RIIα coding sequence from a rat hippocampal cDNA library.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Zeo marker is outside the LTRs and will not be packaged into virus.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUGW-shRIIα-RIIαS97A-IRES-EGFP was a gift from Matthew Gold (Addgene plasmid # 183457 ; http://n2t.net/addgene:183457 ; RRID:Addgene_183457) -
For your References section:
AKAP79 enables calcineurin to directly suppress protein kinase A activity. Church TW, Tewatia P, Hannan S, Antunes J, Eriksson O, Smart TG, Hellgren Kotaleski J, Gold MG. Elife. 2021 Oct 6;10. pii: 68164. doi: 10.7554/eLife.68164. 10.7554/eLife.68164 PubMed 34612814