pcDNA3.1-Zeo-ssIFNG
(Plasmid #183470)

• Purpose: Expression of the Salmo salar gamma interferon
• Depositing Lab: Bertrand Collet
• Publication: Collins et al Fish Shellfish Immunol. 2014 Oct;40(2):644-7. doi: 10.1016/j.fsi.2014.07.025. Epub 2014 Aug 13.

Backbone

• Vector backbone: pcDNA3.1-(-)-Zeo
• Backbone manufacturer: Thermofisher scientific
• Backbone size w/o insert (bp): 5014
• Total vector size (bp): 5489
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Salmo salar interferon gamma precursor
• Alt name: ifng
• Species: Salmo salar
• Insert Size (bp): 543
• GenBank ID: NP_001117030
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GGCTAACTAGAGAACCCACTG
• 3′ sequencing primer: GGCAACTAGAAGGCACAGTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Adamek et al Front Immunol. 2021 Feb 24;12:581786. doi: 10.3389/fimmu.2021.581786. eCollection 2021. https://pubmed.ncbi.nlm.nih.gov/33717065/