pcDNA3.1-Zeo-ssIFNG
(Plasmid
#183470)
-
PurposeExpression of the Salmo salar gamma interferon
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183470 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1-(-)-Zeo
-
Backbone manufacturerThermofisher scientific
- Backbone size w/o insert (bp) 5014
- Total vector size (bp) 5489
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSalmo salar interferon gamma precursor
-
Alt nameifng
-
SpeciesSalmo salar
-
Insert Size (bp)543
-
GenBank IDNP_001117030
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGCTAACTAGAGAACCCACTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Adamek et al Front Immunol. 2021 Feb 24;12:581786. doi: 10.3389/fimmu.2021.581786. eCollection 2021. https://pubmed.ncbi.nlm.nih.gov/33717065/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Zeo-ssIFNG was a gift from Bertrand Collet (Addgene plasmid # 183470 ; http://n2t.net/addgene:183470 ; RRID:Addgene_183470) -
For your References section:
Isolation and activity of the promoters for STAT1 and 2 in Atlantic salmon Salmo salar. Collins C, Ganne G, Collet B. Fish Shellfish Immunol. 2014 Oct;40(2):644-7. doi: 10.1016/j.fsi.2014.07.025. Epub 2014 Aug 13. 10.1016/j.fsi.2014.07.025 PubMed 25128593