pPAP_scFv_V50A
(Plasmid
#183734)
-
PurposeExpresses anti-lysozyme scFv antibody with V50A mutation on MFalpha signal
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183734 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 6698
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAnti-lysozyme scFv
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)732
-
MutationV50A mutation in MFalpha signal
- Promoter AOX1 promoter
-
Tag
/ Fusion Protein
- His6-tag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAAGGAAGCTGCCCTGTCTTAAAC
- 3′ sequencing primer AGTATCAAAAATGAAGCCTGCATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPAP_scFv_V50A was a gift from Jun Ishii (Addgene plasmid # 183734 ; http://n2t.net/addgene:183734 ; RRID:Addgene_183734) -
For your References section:
A streamlined strain engineering workflow with genome-wide screening detects enhanced protein secretion in Komagataella phaffii. Ito Y, Ishigami M, Terai G, Nakamura Y, Hashiba N, Nishi T, Nakazawa H, Hasunuma T, Asai K, Umetsu M, Ishii J, Kondo A. Commun Biol. 2022 Jun 8;5(1):561. doi: 10.1038/s42003-022-03475-w. 10.1038/s42003-022-03475-w PubMed 35676418