Skip to main content

pREMI-ZA
(Plasmid #183736)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183736 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 3540
  • Vector type
    random insertional gene deletion in Komagataella phaffii
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Bleocin (Zeocin), 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sh ble
  • Species
    Streptoalloteichus hindustanus
  • Insert Size (bp)
    860
  • Promoter TEF1 promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GTAAGGAGAAAATACCGCATCAG
  • 3′ sequencing primer ACGCAATTAATGTGAGTTAGCTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pREMI-ZA was a gift from Jun Ishii (Addgene plasmid # 183736 ; http://n2t.net/addgene:183736 ; RRID:Addgene_183736)
  • For your References section:

    A streamlined strain engineering workflow with genome-wide screening detects enhanced protein secretion in Komagataella phaffii. Ito Y, Ishigami M, Terai G, Nakamura Y, Hashiba N, Nishi T, Nakazawa H, Hasunuma T, Asai K, Umetsu M, Ishii J, Kondo A. Commun Biol. 2022 Jun 8;5(1):561. doi: 10.1038/s42003-022-03475-w. 10.1038/s42003-022-03475-w PubMed 35676418