pREMI-ZA
(Plasmid
#183736)
-
PurposePlasmid for a restriction enzyme mediated integration (REMI) in Komagataella phaffii
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183736 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 3540
-
Vector typerandom insertional gene deletion in Komagataella phaffii
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Bleocin (Zeocin), 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSh ble
-
SpeciesStreptoalloteichus hindustanus
-
Insert Size (bp)860
- Promoter TEF1 promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GTAAGGAGAAAATACCGCATCAG
- 3′ sequencing primer ACGCAATTAATGTGAGTTAGCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pREMI-ZA was a gift from Jun Ishii (Addgene plasmid # 183736 ; http://n2t.net/addgene:183736 ; RRID:Addgene_183736) -
For your References section:
A streamlined strain engineering workflow with genome-wide screening detects enhanced protein secretion in Komagataella phaffii. Ito Y, Ishigami M, Terai G, Nakamura Y, Hashiba N, Nishi T, Nakazawa H, Hasunuma T, Asai K, Umetsu M, Ishii J, Kondo A. Commun Biol. 2022 Jun 8;5(1):561. doi: 10.1038/s42003-022-03475-w. 10.1038/s42003-022-03475-w PubMed 35676418