Skip to main content

Lenti-TargetBC-5xTAPE-1-pegRNA-InsertBC
(Plasmid #183790)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183790 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CROP-seq-Guide-Puro
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 9386
  • Modifications to backbone
    Insertion of P2A-GFP-TargetBC-5xTAPE-1 after PuroR gene, and insertion of pegRNA-InsertBC next to U6 promoter.
  • Vector type
    Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    P2A-eGFP-TargetBC-5xTAPE-1
  • Species
    Synthetic
  • Insert Size (bp)
    1000
  • Mutation
    G>A in the gRNA scaffold- please see depositor comment

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aggaccgcgcacctggtgcatgacccgcaagcccggtgcc
  • 3′ sequencing primer aatttgtgaaagattgactggtattcttaactatgttgct
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    pegRNA-InsertBC
  • Species
    Synthetic
  • Insert Size (bp)
    124

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ttcttggctttatatatcttgtggaaaggacgaaacacc
  • 3′ sequencing primer tttttttaagcttggcgtaactagatcttgagacactgct
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note there is a G>A mutation in the gRNA scaffold that the depositor states may affect plasmid function. We recommend running additional diagnostic before use.

Please visit https://www.biorxiv.org/content/10.1101/2021.11.05.467388v1.full for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-TargetBC-5xTAPE-1-pegRNA-InsertBC was a gift from Jay Shendure (Addgene plasmid # 183790 ; http://n2t.net/addgene:183790 ; RRID:Addgene_183790)
  • For your References section:

    A time-resolved, multi-symbol molecular recorder via sequential genome editing. Choi J, Chen W, Minkina A, Chardon FM, Suiter CC, Regalado SG, Domcke S, Hamazaki N, Lee C, Martin B, Daza RM, Shendure J. Nature. 2022 Jul 6. pii: 10.1038/s41586-022-04922-8. doi: 10.1038/s41586-022-04922-8. 10.1038/s41586-022-04922-8 PubMed 35794474