-
PurposeA single construct out of the pool of plasmid for lineage recording experiment using DNA Ticker Tape.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183790 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCROP-seq-Guide-Puro
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 9386
-
Modifications to backboneInsertion of P2A-GFP-TargetBC-5xTAPE-1 after PuroR gene, and insertion of pegRNA-InsertBC next to U6 promoter.
-
Vector typeSynthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameP2A-eGFP-TargetBC-5xTAPE-1
-
SpeciesSynthetic
-
Insert Size (bp)1000
-
MutationG>A in the gRNA scaffold- please see depositor comment
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer aggaccgcgcacctggtgcatgacccgcaagcccggtgcc
- 3′ sequencing primer aatttgtgaaagattgactggtattcttaactatgttgct
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepegRNA-InsertBC
-
SpeciesSynthetic
-
Insert Size (bp)124
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ttcttggctttatatatcttgtggaaaggacgaaacacc
- 3′ sequencing primer tttttttaagcttggcgtaactagatcttgagacactgct
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note there is a G>A mutation in the gRNA scaffold that the depositor states may affect plasmid function. We recommend running additional diagnostic before use.
Please visit https://www.biorxiv.org/content/10.1101/2021.11.05.467388v1.full for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-TargetBC-5xTAPE-1-pegRNA-InsertBC was a gift from Jay Shendure (Addgene plasmid # 183790 ; http://n2t.net/addgene:183790 ; RRID:Addgene_183790) -
For your References section:
A time-resolved, multi-symbol molecular recorder via sequential genome editing. Choi J, Chen W, Minkina A, Chardon FM, Suiter CC, Regalado SG, Domcke S, Hamazaki N, Lee C, Martin B, Daza RM, Shendure J. Nature. 2022 Jul 6. pii: 10.1038/s41586-022-04922-8. doi: 10.1038/s41586-022-04922-8. 10.1038/s41586-022-04922-8 PubMed 35794474