T444T-GFP(NCO)
(Plasmid
#183972)
-
PurposeEnhanced RNAi clone for C. elegans knockdown of non-codon-optimized GFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183972 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneT444T
- Backbone size w/o insert (bp) 2132
- Total vector size (bp) 2846
-
Vector typeWorm Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)HT115
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP (non-codon-optimized)
-
SpeciesSynthetic
-
Insert Size (bp)734
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggtttcgccacctctgacttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGFP insert was synthesized by Twist Bioscience
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.10.17.344069v3 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T444T-GFP(NCO) was a gift from David Matus (Addgene plasmid # 183972 ; http://n2t.net/addgene:183972 ; RRID:Addgene_183972) -
For your References section:
A laboratory module that explores RNA interference and codon optimization through fluorescence microscopy using Caenorhabditis elegans. Palmisano NJ, Azmi MA, Medwig-Kinney TN, Moore FEQ, Rahman R, Zhang W, Adikes RC, Matus DQ. CourseSource, 2022 10.24918/cs.2022.15