pCI-myc-USP10
(Plasmid
#184034)
-
PurposeExpresses myc-USP10 construct in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184034 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCI
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4006
- Total vector size (bp) 7339
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUSP10
-
SpeciesH. sapiens (human)
-
Entrez GeneUSP10 (a.k.a. UBPO)
- Promoter CMVf
-
Tag
/ Fusion Protein
- myc (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-myc-USP10 was a gift from Juan Bonifacino (Addgene plasmid # 184034 ; http://n2t.net/addgene:184034 ; RRID:Addgene_184034) -
For your References section:
The ubiquitin isopeptidase USP10 deubiquitinates LC3B to increase LC3B levels and autophagic activity. Jia R, Bonifacino JS. J Biol Chem. 2021 Jan-Jun;296:100405. doi: 10.1016/j.jbc.2021.100405. Epub 2021 Feb 10. 10.1016/j.jbc.2021.100405 PubMed 33577797