Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Dendra-Rab11a
(Plasmid #184038)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 184038 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    modified pYL4
  • Backbone size w/o insert (bp) 6102
  • Total vector size (bp) 6886
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rab11
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    784
  • GenBank ID
    NM_004663.5
  • Entrez Gene
    RAB11A (a.k.a. YL8)
  • Promoter CMV
  • Tag / Fusion Protein
    • Dendra (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (not destroyed)
  • 3′ cloning site xba1 (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer CGCTATTCTCCGTTGCCAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Stephen Doxsey Lab University of Massachusetts Medical School Program in Molecular Medicine Published in: Hehnly H, Doxsey S. Rab11 endosomes contribute to mitotic spindle organization and orientation. Developmental Cell. 28, 497-507. 2014. Hehnly and Doxsey, The Centrosome Regulates the Rab11- Dependent Recycling Endosome Pathway at Appendages of the Mother Centriole. Current Biology 20: 1944-50, 2012.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Dendra-Rab11a was a gift from Heidi Hehnly (Addgene plasmid # 184038 ; http://n2t.net/addgene:184038 ; RRID:Addgene_184038)
  • For your References section:

    Rab11 endosomes and Pericentrin coordinate centrosome movement during pre-abscission in vivo. Krishnan N, Swoger M, Rathbun LI, Fioramonti PJ, Freshour J, Bates M, Patteson AE, Hehnly H. Life Sci Alliance. 2022 Mar 18;5(7). pii: 5/7/e202201362. doi: 10.26508/lsa.202201362. Print 2022 Jul. 10.26508/lsa.202201362 PubMed 35304423