Dendra-Rab11a
(Plasmid #184038)

• Purpose: Expresses red to green photoconvertible Rab11a
• Depositing Lab: Heidi Hehnly
• Publication: Krishnan et al Life Sci Alliance. 2022 Mar 18;5(7). pii: 5/7/e202201362. doi: 10.26508/lsa.202201362. Print 2022 Jul.

Backbone

• Vector backbone: modified pYL4
• Backbone size w/o insert (bp): 6102
• Total vector size (bp): 6886
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rab11
• Species: H. sapiens (human)
• Insert Size (bp): 784
• GenBank ID: NM_004663.5
• Entrez Gene: RAB11A (a.k.a. YL8)
• Promoter: CMV
• Tag / Fusion Protein:
  • Dendra (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nhe1 (not destroyed)
• 3′ cloning site: xba1 (not destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: CGCTATTCTCCGTTGCCAAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Stephen Doxsey Lab University of Massachusetts Medical School Program in Molecular Medicine Published in: Hehnly H, Doxsey S. Rab11 endosomes contribute to mitotic spindle organization and orientation. Developmental Cell. 28, 497-507. 2014. Hehnly and Doxsey, The Centrosome Regulates the Rab11- Dependent Recycling Endosome Pathway at Appendages of the Mother Centriole. Current Biology 20: 1944-50, 2012.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry