pEGFP-H2B-MCS
(Plasmid
#184041)
-
Purpose(Empty Backbone) Cloning of GFP-H2B fusion proteins
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184041 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size (bp) 4731
-
Modifications to backboneInserted human H2B N-terminal to EGFP
-
Vector typeMammalian Expression
- Promoter CMV
-
Selectable markersNeomycin (select with G418)
-
Tags
/ Fusion Proteins
- GFP (N terminal on backbone)
- H2B (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CAACGGGACTTTCCAAAATG
- 3′ sequencing primer CCTCTACAAATGTGGTATGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-H2B-MCS was a gift from Lienhard Schmitz (Addgene plasmid # 184041 ; http://n2t.net/addgene:184041 ; RRID:Addgene_184041) -
For your References section:
The Aurora B-controlled PP1/RepoMan complex determines the spatial and temporal distribution of mitotic H2B S6 phosphorylation. Pfisterer M, Robert R, Saul VV, Pritz A, Seibert M, Feederle R, Schmitz ML. Open Biol. 2024 May;14(5):230460. doi: 10.1098/rsob.230460. Epub 2024 May 29. 10.1098/rsob.230460 PubMed 38806145