Skip to main content
Addgene

H2B-GFP-INCENP∆cen
(Plasmid #184044)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184044 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    H2B-EGFP-MCS
  • Backbone size w/o insert (bp) 5111
  • Total vector size (bp) 2586
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    INCENP
  • Species
    H. sapiens (human)
  • Mutation
    Truncated to 1-862
  • Entrez Gene
    INCENP
  • Promoter CMV
  • Tags / Fusion Proteins
    • H2B (N terminal on backbone)
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CAACGGGACTTTCCAAAATG
  • 3′ sequencing primer CCTCTACAAATGTGGTATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    H2B-GFP-INCENP∆cen was a gift from Lienhard Schmitz (Addgene plasmid # 184044 ; http://n2t.net/addgene:184044 ; RRID:Addgene_184044)
  • For your References section:

    The Aurora B-controlled PP1/RepoMan complex determines the spatial and temporal distribution of mitotic H2B S6 phosphorylation. Pfisterer M, Robert R, Saul VV, Pritz A, Seibert M, Feederle R, Schmitz ML. Open Biol. 2024 May;14(5):230460. doi: 10.1098/rsob.230460. Epub 2024 May 29. 10.1098/rsob.230460 PubMed 38806145