NTERY08
(Plasmid
#184126)
-
PurposeNanopore-addressable protein reporter for expression in bacterial cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184126 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDB180
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNTERY08
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atgactatgacaagactgaagatttcgaaaactctgctggctg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NTERY08 was a gift from Jeff Nivala (Addgene plasmid # 184126 ; http://n2t.net/addgene:184126 ; RRID:Addgene_184126) -
For your References section:
Multiplexed direct detection of barcoded protein reporters on a nanopore array. Cardozo N, Zhang K, Doroschak K, Nguyen A, Siddiqui Z, Bogard N, Strauss K, Ceze L, Nivala J. Nat Biotechnol. 2022 Jan;40(1):42-46. doi: 10.1038/s41587-021-01002-6. Epub 2021 Aug 12. 10.1038/s41587-021-01002-6 PubMed 34385692