pLY171
(Plasmid
#184145)
-
PurposesgRNA with 3 RNA aptemers BoxB at the 3'-end for CRISPRa
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep15AC
-
Backbone manufacturerp15A vector from pdCas9-bacteria (Plasmid #44249)
- Backbone size w/o insert (bp) 1725
- Total vector size (bp) 3044
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsCulture in the Lennox’s Luria-Bertani (LB) medium (10 g/L peptone, 5 g/L yeast extract, 5 g/L NaCl)
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesgRNA-LEA2-ex3
-
SpeciesSynthetic
- Promoter Plux2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer AACGGTCTGGTTATAGGTACATTGAGCAAC
- 3′ sequencing primer GTTCGTAAGCCATTTCCGCTCGCCGCAGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLY171 was a gift from Baojun Wang (Addgene plasmid # 184145 ; http://n2t.net/addgene:184145 ; RRID:Addgene_184145) -
For your References section:
Reprogrammed tracrRNAs enable repurposing of RNAs as crRNAs and sequence-specific RNA biosensors. Liu Y, Pinto F, Wan X, Yang Z, Peng S, Li M, Cooper JM, Xie Z, French CE, Wang B. Nat Commun. 2022 Apr 11;13(1):1937. doi: 10.1038/s41467-022-29604-x. 10.1038/s41467-022-29604-x PubMed 35410423