Akaby
(Bacterial strain
#184224)
-
PurposeAkaby is a RecB knockout E. coli strain, made for cell-free expression system for linear templates.
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
No maps are available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Bacterial Strain | 184224 | Bacteria in agar stab | 1 | $85 | |
Backbone
-
Vector backbonenone
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Akaby (NEB 5-alpha derivative)
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name∆RecB (RecB gene was replaced with a kanamycin resistant gene, KanR)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Colony PCR Primers:
(1) ATTTCTTCCATCAGGCGGT
(2) CAGTCATAGCCGAATAGCCT
(3) CGGTGCCCTGAATGAACTGC
(4) GTCCCTCTCCGGCATCATGA
Expected product size: 661bp with primer (1) and (2), 1035bp with primer (3) and (4).
Please visit https://www.biorxiv.org/content/10.1101/2021.11.03.467179v1 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Akaby was a gift from Kate Adamala (Addgene plasmid # 184224) -
For your References section:
Akaby-Cell-free protein expression system for linear templates. Sato W, Sharon J, Deich C, Gaut N, Cash B, Engelhart AE, Adamala KP. PLoS One. 2022 Apr 7;17(4):e0266272. doi: 10.1371/journal.pone.0266272. eCollection 2022. 10.1371/journal.pone.0266272 PubMed 35390057