Skip to main content

pCI-T7Max-UTR1-deGFP-8xHis-T500
(Plasmid #178422)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178422 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PCI
  • Backbone size w/o insert (bp) 2800
  • Total vector size (bp) 3593
  • Modifications to backbone
    promoter, RBS, MCS and terminator replaced. BsaI sites removed from the whole backbone.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    deGFP
  • Species
    Synthetic
  • Insert Size (bp)
    719
  • Promoter T7Max
  • Tag / Fusion Protein
    • 8xHis Tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer TTTTGCTCACATGGCTCG
  • 3′ sequencing primer CCCCCTGAACCTGAAACATA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vincent Noireaux Lab
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-T7Max-UTR1-deGFP-8xHis-T500 was a gift from Kate Adamala (Addgene plasmid # 178422 ; http://n2t.net/addgene:178422 ; RRID:Addgene_178422)
  • For your References section:

    T7Max transcription system. Deich C, Cash B, Sato W, Sharon J, Aufdembrink L, Gaut NJ, Heili J, Stokes K, Engelhart AE, Adamala KP. J Biol Eng. 2023 Jan 23;17(1):4. doi: 10.1186/s13036-023-00323-1. 10.1186/s13036-023-00323-1 PubMed 36691081