-
PurposepAIDE containing a full-length CPSMV RNA2 cDNA modified to accomodate an NbPDS fragment.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184268 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAIDE (a pCambia1300 drivative)
-
Backbone manufacturerQu lab
- Backbone size w/o insert (bp) 7872
- Total vector size (bp) 12030
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCPSMV RNA2 cDNA, modified to permit foreign gene insertion between MP and L-CP
-
SpeciesCowpea severe mosaic virus
-
Insert Size (bp)4158
-
MutationThe protease processing site between MP and L-CP duplicated.
-
GenBank IDNC_003544.1
- Promoter CaMV 35S with duplicated enhancer
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAACGACAATCTGATCCAAGCTCAA
- 3′ sequencing primer GAGTTAGCTCACTCATTAGGCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.researchsquare.com/article/rs-1463088/v1 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FZ-NbPDS was a gift from Feng Qu (Addgene plasmid # 184268 ; http://n2t.net/addgene:184268 ; RRID:Addgene_184268) -
For your References section:
A cowpea severe mosaic virus-based vector simplifies virus-induced gene silencing and foreign protein expression in soybean. Zaulda FA, Yang SH, Han J, Mlotshwa S, Dorrance A, Qu F. Plant Methods. 2022 Oct 28;18(1):116. doi: 10.1186/s13007-022-00950-7. 10.1186/s13007-022-00950-7 PubMed 36307846