pEGFP-RepoMan-RATA
(Plasmid
#184270)
-
PurposeExpresses shRNA resistant GFP-RepoMan RATA Mutant
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184270 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 7879
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecell division cycle associated 2
-
Alt nameCDCA2
-
Alt nameRepo-Man
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3183
-
MutationV383A, F395A
-
Entrez GeneCDCA2 (a.k.a. PPP1R81, Repo-Man)
- Promoter CMV
-
Tags
/ Fusion Proteins
- GFP (N terminal on backbone)
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCTCTCCTGAAACAAACCATCT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-RepoMan-RATA was a gift from Lienhard Schmitz (Addgene plasmid # 184270 ; http://n2t.net/addgene:184270 ; RRID:Addgene_184270) -
For your References section:
The Aurora B-controlled PP1/RepoMan complex determines the spatial and temporal distribution of mitotic H2B S6 phosphorylation. Pfisterer M, Robert R, Saul VV, Pritz A, Seibert M, Feederle R, Schmitz ML. Open Biol. 2024 May;14(5):230460. doi: 10.1098/rsob.230460. Epub 2024 May 29. 10.1098/rsob.230460 PubMed 38806145