Skip to main content

pDS2142
(Plasmid #184273)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184273 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNIMX
  • Total vector size (bp) 10076
  • Modifications to backbone
    Replacement of the Tet-on system by Te-off, replacement of SAT1 dominant marker by HygR dominant marker
  • Vector type
    Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CatTA
  • Alt name
    Tet-off system
  • Species
    Synthetic
  • Insert Size (bp)
    984
  • Promoter TDH3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CATCAACAAACTTTACAATC
  • 3′ sequencing primer ACAAAACCAGATTTCCAGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDS2142 was a gift from Dominique Sanglard (Addgene plasmid # 184273 ; http://n2t.net/addgene:184273 ; RRID:Addgene_184273)
  • For your References section:

    Candida albicans commensalism in the oral mucosa is favoured by limited virulence and metabolic adaptation. Lemberg C, Martinez de San Vicente K, Frois-Martins R, Altmeier S, Tran VDT, Mertens S, Amorim-Vaz S, Rai LS, d'Enfert C, Pagni M, Sanglard D, LeibundGut-Landmann S. PLoS Pathog. 2022 Apr 11;18(4):e1010012. doi: 10.1371/journal.ppat.1010012. eCollection 2022 Apr. 10.1371/journal.ppat.1010012 PubMed 35404986
Commonly requested with: