pDS2142
(Plasmid
#184273)
-
PurposeTet-off genome insertion system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepNIMX
- Total vector size (bp) 10076
-
Modifications to backboneReplacement of the Tet-on system by Te-off, replacement of SAT1 dominant marker by HygR dominant marker
-
Vector typeYeast Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCatTA
-
Alt nameTet-off system
-
SpeciesSynthetic
-
Insert Size (bp)984
- Promoter TDH3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer CATCAACAAACTTTACAATC
- 3′ sequencing primer ACAAAACCAGATTTCCAGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDS2142 was a gift from Dominique Sanglard (Addgene plasmid # 184273 ; http://n2t.net/addgene:184273 ; RRID:Addgene_184273) -
For your References section:
Candida albicans commensalism in the oral mucosa is favoured by limited virulence and metabolic adaptation. Lemberg C, Martinez de San Vicente K, Frois-Martins R, Altmeier S, Tran VDT, Mertens S, Amorim-Vaz S, Rai LS, d'Enfert C, Pagni M, Sanglard D, LeibundGut-Landmann S. PLoS Pathog. 2022 Apr 11;18(4):e1010012. doi: 10.1371/journal.ppat.1010012. eCollection 2022 Apr. 10.1371/journal.ppat.1010012 PubMed 35404986