pAAV-HDC-DIO-GFP-shRNA.scramble
(Plasmid
#184331)
-
PurposeExpresses scramble shRNA for control expts. Flexed (DIO) cassette driven by hdc promoter fragment for pan neuronal expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184331 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 6764
-
Vector typeMammalian Expression, Mouse Targeting, AAV, RNAi, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehdc pan neuronal gene promoter, flex switch, GFP, scramble shRNA
-
gRNA/shRNA sequencescramble control
-
SpeciesSynthetic
- Promoter histidine decarboxylase promoter fragment that gives pan-neuronal expression
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAGATGCACTGGCTGCCAG
- 3′ sequencing primer GAAGTTCACCTTGATGCCGTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-HDC-DIO-GFP-shRNA.scramble was a gift from William Wisden (Addgene plasmid # 184331 ; http://n2t.net/addgene:184331 ; RRID:Addgene_184331) -
For your References section:
NMDA Receptors in the Lateral Preoptic Hypothalamus Are Essential for Sustaining NREM and REM Sleep. Miracca G, Anuncibay-Soto B, Tossell K, Yustos R, Vyssotski AL, Franks NP, Wisden W. J Neurosci. 2022 May 31. pii: JNEUROSCI.0350-21.2022. doi: 10.1523/JNEUROSCI.0350-21.2022. 10.1523/JNEUROSCI.0350-21.2022 PubMed 35649726