pCMV10-3xFLAG-prs-MCP1
(Plasmid
#184341)
-
PurposeExpress yeast MCP1 in Expi293F cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV10
- Backbone size w/o insert (bp) 6281
- Total vector size (bp) 7190
-
Modifications to backboneDigested with NotI and BamHI
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYeast MCP1
-
Alt nameMDM10 complementing protein 1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)909
-
GenBank IDNC_001147.6 YOR228C
-
Entrez GeneMCP1 (a.k.a. YOR228C)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG-PreScission cleavage site (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aggggccccttgcggccgccATGATAAAGTTGCATGAAGTGCC
- 3′ sequencing primer agggatgccacccgggatccctaattcacgtgcaacagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV10-3xFLAG-prs-MCP1 was a gift from Karin Reinisch (Addgene plasmid # 184341 ; http://n2t.net/addgene:184341 ; RRID:Addgene_184341) -
For your References section:
Structural and biochemical insights into lipid transport by VPS13 proteins. Adlakha J, Hong Z, Li P, Reinisch KM. J Cell Biol. 2022 Jun 6;221(5):e202202030. doi: 10.1083/jcb.202202030. Epub 2022 Mar 31. 10.1083/jcb.202202030 PubMed 35357422