Skip to main content
Addgene

BPK1520-sgRNA GLB1
(Plasmid #184378)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184378 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    BPK1520
  • Backbone size w/o insert (bp) 2280
  • Modifications to backbone
    sgRNA n°8 : caccGGCGAGTATGAACTTgtgag
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting GLB1
  • gRNA/shRNA sequence
    GGCGAGTATGAACTTGTGAG
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_000404.2
  • Entrez Gene
    GLB1 (a.k.a. EBP, ELNR1, MPS4B)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BPK1520-sgRNA GLB1 was a gift from David Gilot (Addgene plasmid # 184378 ; http://n2t.net/addgene:184378 ; RRID:Addgene_184378)

  • For your References section:

    Gene Editing Corrects In Vitro a G > A GLB1 Transition from a GM1 Gangliosidosis Patient. Leclerc D, Goujon L, Jaillard S, Nouyou B, Cluzeau L, Damaj L, Dubourg C, Etcheverry A, Levade T, Froissart R, Dreano S, Guillory X, Eriksson LA, Launay E, Mouriaux F, Belaud-Rotureau MA, Odent S, Gilot D. CRISPR J. 2023 Feb;6(1):17-31. doi: 10.1089/crispr.2022.0045. Epub 2023 Jan 11. 10.1089/crispr.2022.0045 PubMed 36629845
Related items: