Skip to main content

Sp(AU)sgRNA-mKO2
(Plasmid #184443)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184443 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA with AU flip, mKO2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gaatagagttaggcagggatattc
  • 3′ sequencing primer cctatagtgagtcgtatta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sp(AU)sgRNA-mKO2 was a gift from Rhys Allan (Addgene plasmid # 184443 ; http://n2t.net/addgene:184443 ; RRID:Addgene_184443)
  • For your References section:

    Identification and characterization of the long noncoding RNA Dreg1 as a novel regulator of Gata3. Chan WF, Coughlan HD, Iannarella N, Smyth GK, Johanson TM, Keenan CR, Allan RS. Immunol Cell Biol. 2020 Sep 24. doi: 10.1111/imcb.12408. 10.1111/imcb.12408 PubMed 32970351