Sp(AU)sgRNA-mKO2
(Plasmid
#184443)
-
PurposesgRNA with AU flip (sgRNA2.0), mKO2 as selection marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184443 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA with AU flip, mKO2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gaatagagttaggcagggatattc
- 3′ sequencing primer cctatagtgagtcgtatta (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Sp(AU)sgRNA-mKO2 was a gift from Rhys Allan (Addgene plasmid # 184443 ; http://n2t.net/addgene:184443 ; RRID:Addgene_184443) -
For your References section:
Identification and characterization of the long noncoding RNA Dreg1 as a novel regulator of Gata3. Chan WF, Coughlan HD, Iannarella N, Smyth GK, Johanson TM, Keenan CR, Allan RS. Immunol Cell Biol. 2020 Sep 24. doi: 10.1111/imcb.12408. 10.1111/imcb.12408 PubMed 32970351