Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pVITRO1-mCardinal-NLS
(Plasmid #184450)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 184450 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pVITRO1-hygro-mcs
  • Backbone manufacturer
    InvivoGen
  • Backbone size w/o insert (bp) 6491
  • Total vector size (bp) 6762
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCardinal-3xNLS
  • Species
    Synthetic
  • Insert Size (bp)
    271
  • Mutation
    WT
  • Promoter Rat EF1α

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspEI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer N/A
  • 3′ sequencing primer GGAAAGACCAGGCGGAGTTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVITRO1-mCardinal-NLS was a gift from Chuan-Hsiang Huang (Addgene plasmid # 184450 ; http://n2t.net/addgene:184450 ; RRID:Addgene_184450)
  • For your References section:

    Deciphering cell signaling networks with massively multiplexed biosensor barcoding. Yang JM, Chi WY, Liang J, Takayanagi S, Iglesias PA, Huang CH. Cell. 2021 Dec 9;184(25):6193-6206.e14. doi: 10.1016/j.cell.2021.11.005. Epub 2021 Nov 26. 10.1016/j.cell.2021.11.005 PubMed 34838160