pUltra-Hot-PC
(Plasmid
#184466)
-
PurposeLentiviral vector for bi-cistronic expression of mCherry and PC (seperated by P2A)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184466 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUltra-Hot
-
Backbone manufacturerobtained from Addgene (#24130)
- Backbone size w/o insert (bp) 8317
- Total vector size (bp) 11770
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePyruvate Carboxylase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3537
-
GenBank IDNM_000920
-
Entrez GenePC (a.k.a. PCB)
- Promoter UbC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ggatctggagcaacaaacttc
- 3′ sequencing primer gtatccacatagcgtaaaagg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe sequence for PC was from OriGene CAT#: SC122580
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUltra-Hot-PC was a gift from Gerardo Ferbeyre (Addgene plasmid # 184466 ; http://n2t.net/addgene:184466 ; RRID:Addgene_184466) -
For your References section:
A hydride transfer complex reprograms NAD metabolism and bypasses senescence. Igelmann S, Lessard F, Uchenunu O, Bouchard J, Fernandez-Ruiz A, Rowell MC, Lopes-Paciencia S, Papadopoli D, Fouillen A, Ponce KJ, Huot G, Mignacca L, Benfdil M, Kalegari P, Wahba HM, Pencik J, Vuong N, Quenneville J, Guillon J, Bourdeau V, Hulea L, Gagnon E, Kenner L, Moriggl R, Nanci A, Pollak MN, Omichinski JG, Topisirovic I, Ferbeyre G. Mol Cell. 2021 Sep 16;81(18):3848-3865.e19. doi: 10.1016/j.molcel.2021.08.028. 10.1016/j.molcel.2021.08.028 PubMed 34547241