Skip to main content

pXPR_BRD003 FDX1-2
(Plasmid #184477)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184477 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    BRD003
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FDX1
  • gRNA/shRNA sequence
    CACCGTGGCATATGGACTAACAGAC
  • Species
    H. sapiens (human)
  • Entrez Gene
    FDX1 (a.k.a. ADX, FDX, LOH11CR1D)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_BRD003 FDX1-2 was a gift from Todd Golub & Peter Tsvetkov (Addgene plasmid # 184477 ; http://n2t.net/addgene:184477 ; RRID:Addgene_184477)
  • For your References section:

    Copper induces cell death by targeting lipoylated TCA cycle proteins. Tsvetkov P, Coy S, Petrova B, Dreishpoon M, Verma A, Abdusamad M, Rossen J, Joesch-Cohen L, Humeidi R, Spangler RD, Eaton JK, Frenkel E, Kocak M, Corsello SM, Lutsenko S, Kanarek N, Santagata S, Golub TR. Science. 2022 Mar 18;375(6586):1254-1261. doi: 10.1126/science.abf0529. Epub 2022 Mar 17. 10.1126/science.abf0529 PubMed 35298263