pHACK-QF2-AgU6-mCherry
(Plasmid
#184530)
-
PurposeHACK-compatible plasmid for generating T2A-QF2 knockins in Anopheles mosquitoes with a mCherry selectable marker.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184530 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneT2A-QF2
- Total vector size (bp) 8180
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameQF2
-
SpeciesD. melanogaster (fly), Synthetic
-
Insert Size (bp)1053
- Promoter Anopheles U6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbsl (unknown if destroyed)
- 3′ cloning site Xho1 (unknown if destroyed)
- 5′ sequencing primer GTTTGAATTGAATTGTCGCTCCGTAGACGAAGC
- 3′ sequencing primer GCTTCGTCTACGGAGCGACAATTCAATTCAAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHACK-QF2-AgU6-mCherry was a gift from Christopher Potter (Addgene plasmid # 184530 ; http://n2t.net/addgene:184530 ; RRID:Addgene_184530) -
For your References section:
A spatial map of antennal-expressed ionotropic receptors in the malaria mosquito. Raji JI, Konopka JK, Potter CJ. Cell Rep. 2023 Feb 10;42(2):112101. doi: 10.1016/j.celrep.2023.112101. 10.1016/j.celrep.2023.112101 PubMed 36773296