Skip to main content

pAcrVIB1
(Plasmid #184566)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184566 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET24(+)
  • Backbone manufacturer
    Twist Bioscience
  • Backbone size w/o insert (bp) 5272
  • Total vector size (bp) 5620
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    anti-CRISPR protein inhibiting Cas13b nucleases
  • Alt name
    AcrVIB1
  • Species
    Riemerella anatipestifer
  • Insert Size (bp)
    348
  • GenBank ID
    WP_004917816.1
  • Promoter T7 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer atcttccccatcggtgatgtc
  • 3′ sequencing primer gcccactacgtgaaccatca
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Twist Bioscience

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAcrVIB1 was a gift from Chase Beisel (Addgene plasmid # 184566 ; http://n2t.net/addgene:184566 ; RRID:Addgene_184566)
  • For your References section:

    Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413