pLPC-FLAG.Mm.DMAP1
(Plasmid
#184650)
-
PurposeRetroviral expression of mouse DMAP1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184650 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLPC
- Backbone size w/o insert (bp) 5709
- Total vector size (bp) 7102
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDmap1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1393
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GGATCCGCTACGGGCGCAGATGTA
- 3′ sequencing primer AAGCTAGCTTGCCAAACCTACAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.11.02.467017v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLPC-FLAG.Mm.DMAP1 was a gift from Agnel Sfeir (Addgene plasmid # 184650 ; http://n2t.net/addgene:184650 ; RRID:Addgene_184650) -
For your References section:
Rap1 regulates TIP60 function during fate transition between two-cell-like and pluripotent states. Barry RM, Sacco O, Mameri A, Stojaspal M, Kartsonis W, Shah P, De Ioannes P, Hofr C, Cote J, Sfeir A. Genes Dev. 2022 Feb 24. pii: gad.349039.121. doi: 10.1101/gad.349039.121. 10.1101/gad.349039.121 PubMed 35210222