Skip to main content

pSN838
(Plasmid #184826)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184826 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmScarlet_C1
  • Backbone manufacturer
    Addgene #85042
  • Backbone size w/o insert (bp) 4718
  • Total vector size (bp) 7829
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KIF5A (∆exon27)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3111
  • Mutation
    ∆exon27 form
  • GenBank ID
    BC146670
  • Entrez Gene
    KIF5A (a.k.a. ALS25, D12S1889, MY050, NEIMY, NKHC, SPG10)
  • Promoter CMV
  • Tag / Fusion Protein
    • mScarlet (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSN838 was a gift from Kyoko Chiba (Addgene plasmid # 184826 ; http://n2t.net/addgene:184826 ; RRID:Addgene_184826)
  • For your References section:

    An ALS-associated KIF5A mutant forms oligomers and aggregates and induces neuronal toxicity. Nakano J, Chiba K, Niwa S. Genes Cells. 2022 Apr 17. doi: 10.1111/gtc.12936. 10.1111/gtc.12936 PubMed 35430760