pPgiCas13b
(Plasmid
#184833)
-
PurposeInducible expression of PgiCas13b nuclease in bacteria.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184833 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD33
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 7400
-
Modifications to backboneArabinose cassette exchanged with insert
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas13b nuclease from Porphyromonas gingivalis
-
Alt namePgiCas13b
-
SpeciesPorphyromonas gingivalis
-
Insert Size (bp)3360
-
GenBank IDAJW4
- Promoter T7 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gaaccttcgaaaaaccgccc
- 3′ sequencing primer actcagaagtgaaacgccgt
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPgiCas13b was a gift from Chase Beisel (Addgene plasmid # 184833 ; http://n2t.net/addgene:184833 ; RRID:Addgene_184833) -
For your References section:
Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413