pPgiCas13b-gRNA-NT
(Plasmid
#184835)
-
PurposeConstitutive expression of single-spacer CRISPR array with non-targeting spacer for PgiCas13b in bacteria.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184835 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepACYC184
- Backbone size w/o insert (bp) 4258
- Total vector size (bp) 4360
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameConstitutive expression of single-spacer CRISPR array with a nontargeting spacer for PgiCas13b in bacteria.
-
gRNA/shRNA sequenceCTCGTATGTTGTGTGGAATTGTGAGCGGAT
-
SpeciesPorphyromonas gingivalis
- Promoter J23119
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer gaaccttcgaaaaaccgccc
- 3′ sequencing primer atcttccccatcggtgatgtc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPgiCas13b-gRNA-NT was a gift from Chase Beisel (Addgene plasmid # 184835 ; http://n2t.net/addgene:184835 ; RRID:Addgene_184835) -
For your References section:
Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413