pPlacPbuCas13b-gRNA-NT
(Plasmid
#184838)
-
PurposeExpression of single-spacer CRISPR array with a shortened non-targeting spacer for PbuCas13b and expression of PbuCas13b in bacteria.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184838 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC184
- Backbone size w/o insert (bp) 4289
- Total vector size (bp) 7799
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCo-expression of single-spacer CRISPR array with a nontargeting spacer for PbuCas13b and PbuCas13b nuclease in bacteria.
-
gRNA/shRNA sequenceCGTACCTTCGTAC
-
SpeciesPrevotella buccae
- Promoter J23119 and lac promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGAAGTCATGCGCCGGTTA
- 3′ sequencing primer catacccacgccgaaacaag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPlacPbuCas13b-gRNA-NT was a gift from Chase Beisel (Addgene plasmid # 184838 ; http://n2t.net/addgene:184838 ; RRID:Addgene_184838) -
For your References section:
Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413