Skip to main content
Addgene

pPlacPbuCas13b-gRNA-T-MS2
(Plasmid #184839)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184839 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pACYC184
  • Backbone size w/o insert (bp) 4245
  • Total vector size (bp) 7816
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
  • gRNA/shRNA sequence
    tacataaagagttgaacttctttgttgtct
  • Species
    Prevotella buccae
  • Promoter J23119 and lac promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTGAAGTCATGCGCCGGTTA
  • 3′ sequencing primer catacccacgccgaaacaag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPlacPbuCas13b-gRNA-T-MS2 was a gift from Chase Beisel (Addgene plasmid # 184839 ; http://n2t.net/addgene:184839 ; RRID:Addgene_184839)
  • For your References section:

    Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413