Skip to main content

P70a-deGFP-sc101-kan
(Plasmid #184841)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184841 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUA66
  • Backbone size w/o insert (bp) 4182
  • Total vector size (bp) 4860
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    When picking a colony, make sure it expresses GFP. Alternatively, when using KL740 instead of DH5alpha as growth strain, grow at 29°C.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    green fluorescent protein
  • Alt name
    deGFP
  • Species
    Synthetic
  • Promoter promoter OR2-OR1

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TATCACGAGGCCCTTTCGTC
  • 3′ sequencing primer GTTGAAGGCTCTCAAGGGCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P70a-deGFP-sc101-kan was a gift from Chase Beisel (Addgene plasmid # 184841 ; http://n2t.net/addgene:184841 ; RRID:Addgene_184841)
  • For your References section:

    Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413
Commonly requested with: