Skip to main content

pMA5460
(Plasmid #184855)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184855 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMA4659
  • Backbone manufacturer
    Alexeyev lab
  • Backbone size w/o insert (bp) 7130
  • Total vector size (bp) 7792
  • Vector type
    Mammalian Expression, Retroviral ; PhiC31 attP-attB recombination/excision
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TFAM
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    753
  • Mutation
    WT
  • Entrez Gene
    TFAM (a.k.a. MTDPS15, MTTF1, MTTFA, TCF6, TCF6L1, TCF6L2, TCF6L3)
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer acctacccgagtcggacttt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMA5460 was a gift from Mikhail Alexeyev (Addgene plasmid # 184855 ; http://n2t.net/addgene:184855 ; RRID:Addgene_184855)
  • For your References section:

    A Method for In Situ Reverse Genetic Analysis of Proteins Involved mtDNA Replication. Kozhukhar N, Spadafora D, Rodriguez YAR, Alexeyev MF. Cells. 2022 Jul 11;11(14). pii: cells11142168. doi: 10.3390/cells11142168. 10.3390/cells11142168 PubMed 35883613