pDrop
(Plasmid
#184872)
-
PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for in-vivo excision of transferred DNA for homologous recombination and counter-selection for successful integration.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backboneEntry vector
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelacZalpha,ccdB
-
gRNA/shRNA sequencetagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcac and gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt
-
SpeciesE. coli, lambda phage
Cloning Information
- Cloning method Unknown
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://arxiv.org/pdf/2111.11880.pdf for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDrop was a gift from Patrick Sobetzko (Addgene plasmid # 184872 ; http://n2t.net/addgene:184872 ; RRID:Addgene_184872) -
For your References section:
A multifunctional system for genome editing and large-scale interspecies gene transfer. Teufel M, Klein CA, Mager M, Sobetzko P. Nat Commun. 2022 Jun 14;13(1):3430. doi: 10.1038/s41467-022-30843-1. 10.1038/s41467-022-30843-1 PubMed 35701417