Skip to main content

pDrop
(Plasmid #184872)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 184872 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    Entry vector
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lacZalpha,ccdB
  • gRNA/shRNA sequence
    tagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcac and gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt
  • Species
    E. coli, lambda phage

Cloning Information

  • Cloning method Unknown

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://arxiv.org/pdf/2111.11880.pdf for preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDrop was a gift from Patrick Sobetzko (Addgene plasmid # 184872 ; http://n2t.net/addgene:184872 ; RRID:Addgene_184872)
  • For your References section:

    A multifunctional system for genome editing and large-scale interspecies gene transfer. Teufel M, Klein CA, Mager M, Sobetzko P. Nat Commun. 2022 Jun 14;13(1):3430. doi: 10.1038/s41467-022-30843-1. 10.1038/s41467-022-30843-1 PubMed 35701417