Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJET-col2a1a-KI-donor
(Plasmid #184876)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184876 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJET1.2/blunt
  • Backbone manufacturer
    ThermoFisher Scientific
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 7699
  • Vector type
    Cre/Lox, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Collagen2a1a 5' homology arm
  • Alt name
    Col2a1a 5' homology arm
  • Species
    Oryzias latipes
  • Insert Size (bp)
    256
  • GenBank ID

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
  • 3′ sequencing primer GGCGATCCCTGAACATGTCCAT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Collagen2a1a 3' homology arm
  • Alt name
    Col2a1a 3' homology arm
  • Species
    Oryzias latipes
  • Insert Size (bp)
    198
  • GenBank ID

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGTTACAACTGGCTATGCCTGA
  • 3′ sequencing primer AGAACATCGATTTTCCATGGCAG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    p2a-CreERT2
  • Species
    Synthetic
  • Insert Size (bp)
    2040

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AATGAAAACCTCACGCTTGC
  • 3′ sequencing primer CTAGTAACGGCCGCCAGTGT
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    Myosin light chain 2 promoter
  • Alt name
    Cmlc2 promoter
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    899

Cloning Information for Gene/Insert 4

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCGCCGTCCAGCTCGACCA
  • 3′ sequencing primer GTGCCCTTAAGTGCCAACAT
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    EGFP
  • Species
    Synthetic
  • Insert Size (bp)
    718

Cloning Information for Gene/Insert 5

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCTGGATCTACGTAATACGACTCA
  • 3′ sequencing primer TGCTGGAATCTGAGCACTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJET-col2a1a-KI-donor was a gift from Christoph Winkler (Addgene plasmid # 184876 ; http://n2t.net/addgene:184876 ; RRID:Addgene_184876)
  • For your References section:

    A novel non-disruptive and efficient knock-in allows fate tracing of resident osteoblast progenitors during repair of vertebral lesions in medaka. Hui TW, Winkler C. Development. 2022 May 20. pii: 275483. doi: 10.1242/dev.200238. 10.1242/dev.200238 PubMed 35593425