pEasyG2_mic
(Plasmid
#184916)
-
PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_mic recombines in vivo with a PCR product from pEasyG2_zeo/nat/hph.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA scaffold
-
gRNA/shRNA sequenceGTTTTAGAGCTAGAAATAGCAAGTT
-
SpeciesStreptococcus pyogenes
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEasyG2_mic was a gift from Jeferson Gross (Addgene plasmid # 184916 ; http://n2t.net/addgene:184916 ; RRID:Addgene_184916) -
For your References section:
EasyGuide Plasmids Support in Vivo Assembly of gRNAs for CRISPR/Cas9 Applications in Saccharomyces cerevisiae. Jacobus AP, Barreto JA, de Bem LS, Menegon YA, Fier I, Bueno JGR, Dos Santos LV, Gross J. ACS Synth Biol. 2022 Nov 18;11(11):3886-3891. doi: 10.1021/acssynbio.2c00348. Epub 2022 Oct 18. 10.1021/acssynbio.2c00348 PubMed 36257021