TFAP4_BHLH_5-1
(Plasmid
#185054)
-
PurposeDeletion of BHLH domain of mouse TFAP4 in combination with TFAP4_BHLH_3-2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLentiCRISPR-EGFP
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTFAP4_5_1_gRNA
-
gRNA/shRNA sequenceCACCgGGGTCAGTGGAATGTTGGCT
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
Entrez GeneTcfap4 (a.k.a. AP-4, Tfap4, bHLHc41, AI642933, D930048N17Rik)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TFAP4_BHLH_5-1 was a gift from Constance Ciaudo (Addgene plasmid # 185054 ; http://n2t.net/addgene:185054 ; RRID:Addgene_185054) -
For your References section:
Global and precise identification of functional miRNA targets in mESCs by integrative analysis. Schaefer M, Nabih A, Spies D, Hermes V, Bodak M, Wischnewski H, Stalder P, Ngondo RP, Liechti LA, Sajic T, Aebersold R, Gatfield D, Ciaudo C. EMBO Rep. 2022 Jul 28:e54762. doi: 10.15252/embr.202254762. 10.15252/embr.202254762 PubMed 35899551