Skip to main content

pAIO-Ef1a-PE2-GFP:KCNQ2-C201R_pp
(Plasmid #185061)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185061 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV
  • Backbone manufacturer
    SignaGen Inc
  • Backbone size w/o insert (bp) 15400
  • Total vector size (bp) 15400
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    U6:pegRNA:scaffold:PBS+RT template
  • gRNA/shRNA sequence
    gRNA:GCAGAATCTGCAGGAAGCAC; PBS+RT: TCCGGAGTCTGCGCTTCCTGCAGATT
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PaqCI (destroyed during cloning)
  • 3′ cloning site PaqCI (destroyed during cloning)
  • 5′ sequencing primer GTGCAGGGGAAAGAATAGTAGACA
  • 3′ sequencing primer AGCGATCTCTGGGTTCTACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone was generated by Signagen by cloning PE2-P2A-GFP (Addgene #132776) insert in a pLV backbone (#184445). Further addition of PaqCI sites are performed in our lab. In this plasmid, we cloned KCNQ2 pegRNA in the plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is based on the pLV-EF1A:PE2-P2A-GFP (#184445). Only additional KCNQ2 pegRNA is cloned in the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAIO-Ef1a-PE2-GFP:KCNQ2-C201R_pp was a gift from Bobby Koeleman (Addgene plasmid # 185061 ; http://n2t.net/addgene:185061 ; RRID:Addgene_185061)